Альтернативные варианты мРНК альфа-цепи рецептора интерлейкина-2 при раке толстой кишки

Резюме

Введение. Альфа-цепь рецептора интерлейкина (ИЛ)-2 кодируется полноразмерной мРНК, имеющей несколько делегированных альтернативных вариантов, функция которых неизвестна. Получение информации о встречаемости альтернативных вариантов мРНК α-цепи IL-2R при раке толстой кишки поможет установить их роль в механизмах противоопухолевого иммунитета.

Цель исследования - определить в крови здоровых лиц и в крови и опухолях пациентов с раком толстой кишки содержание растворимых молекул CD25, полноразмерную форму мРНК IL-2Rα (мРНК CD25), кодирующую функционально активную α-цепь рецептора, и формы с делецией 4-го экзона (мРНК CD25Exo4Del) и делецией 4-го и 5-го экзонов (мРНК CD25Exo4-5Del), кодирующие белок, неспособный связывать ИЛ-2 из-за отсутствия 4-го экзона. Сопоставить экспрессию альтернативных вариантов мРНК IL-2Rα с экспрессией генов, кодирующих CD38, ICAM-1, Fas и ряд раково-тестикулярных антигенов (MAGEA1-MAGEA6, CT7 (MAGEC1), GAGE1-GAGE8, NY-ESO-1, SSX1,2,4, TRAG3 и XAGE1).

Материал и методы. В работе использованы 49 образцов опухоли и 10 образцов периферической крови пациентов с раком толстой кишки. Исследование проведено методом полимеразной цепной реакции с обратной транскрипцией.

Результаты. Показано, что три альтернативных варианта мРНК IL-2Ra присутствуют в крови как здоровых лиц, так и пациентов с раком толстой кишки. В опухолях альтернативные варианты мРНК IL-2Ra встречались с различной частотой. Чаще всего обнаруживалась мРНК полноразмерной формы, с промежуточной частотой - мРНК CD25Exo-4Del и реже всего - мРНК CD25Exo4-5Del. Наблюдалась тенденция к снижению частоты выявления мРНК CD25Exo4-5Del на поздних стадиях заболевания. Выявлено повышение частоты экспрессии ICAM-1 в опухолях, не содержащих мРНК CD25Exo4-5Del, и увеличение уровня растворимых молекул CD25 в сыворотке крови при отсутствии в опухоли мРНК CD25Exo4Del.

Заключение. Установлена регуляторная роль продуктов делетированных форм мРНК IL-2Rα, приводящая к активации регуляторных Т-клеток, усилению иммуносупрессии и прогрессии опухолевого роста.

Ключевые слова:альфа-цепь рецептора интерлейкина-2; альтернативные варианты мРНК; рак толстой кишки; регуляторные Т-клетки

Для цитирования: Новиков В.В., Шумилова С.В., Новиков Д.В., Алясова А.В., Евсегнеева И.В., Караулов А.В. Альтернативные варианты мРНК альфа-цепи рецептора интерлейкина-2 при раке толстой кишки. Иммунология. 2020; 41 (2): 144-153. DOI: 10.33029/0206-4952-2020-41-2-144-153

Финансирование. Исследование не имело спонсорской поддержки.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

Введение

Хорошо известно, что канцерогенез характеризуется многочисленными изменениями генома и транскриптома опухолевых клеток. В то же время на развитие опухоли принципиальным образом влияет состояние иммунитета, в частности популяционный состав и функциональная активность клеток иммунной системы, инфильтрирующих опухоль. Присутствующие в опухоли лимфоциты гетерогенны по популяционному составу и функциональной нагрузке. Все большее значение отводится субпопуляции регуляторных Т-клеток (Трег), угнетающих иммунный ответ хозяина на антигены опухоли. Одним из маркеров Трег служит мембранная молекула CD25, которая является α-цепью рецептора интерлейкина (ИЛ)-2 и с высокой плотностью представлена на поверхности Трег. Кроме этой популяции лимфоцитов, молекула CD25 экспрессируется на мембране других популяций активированных лимфоцитов и моноцитов, но с гораздо меньшей плотностью. Имеются также сообщения о присутствии молекулы CD25 на мембране опухолевых клеток [1].

Рецептор ИЛ-2 (IL-2R), обладающий высокой аффинностью, построен из α-, β- и γ-цепей и при связывании ИЛ-2 передает в клетку сигнал к пролиферации. Показано существование ряда альтернативных форм матричной РНК α-субъединицы IL-2R (CD25) [2, 3]. Полноразмерная форма кодирует α-цепь, связывающуюся с ИЛ-2, формы с делецией 4-го экзона способны кодировать a-цепи, не связывающие ИЛ-2 [4]. Ранее нами были разработаны методы, позволяющие определять полноразмерную мРНК IL-2Rα (CD25), форму с делецией 4-го экзона (мРНК CD25Exo4Del) и форму с делецией 4-го и 5-го экзонов (мРНК CD25Exo4-5Del) [5]. В доступной научной литературе отсутствует информация о встречаемости альтернативных вариантов мРНК α-цепи IL-2R в опухолях и роли их продуктов в механизмах противоопухолевого иммунитета, их влиянии на развитие новообразований, в том числе при раке толстой кишки.

Целью настоящей работы является изучение роли альтернативных вариантов мРНК α-субъединицы IL-2R в патогенетических механизмах развития рака толстой кишки.

Материал и методы

В исследование были включены 49 образцов опухоли и 10 образцов периферической крови пациентов с раком толстой кишки в возрасте от 45 до 84 лет, проходивших лечение в хирургическом отделении ГБУЗ Нижегородской области "Нижегородская областная клиническая больница им. Н.А. Семашко", а также 10 образцов периферической крови сопоставимых по возрасту здоровых добровольцев, полученных в клинических лабораториях городских больниц №34 и №5 (Нижний Новгород). Исследования проводились в соответствии с этическими нормами, с письменного информированного согласия пациентов и добровольцев, выполнялись строго в рамках Хельсинкской декларации ВМА 2000 г. и протокола Конвенции Совета Европы о правах человека и биомедицине 1999 г. Группы пациентов формировали после постановки диагноза на основании клинического, морфологического, эндоскопического, рентгенологического обследования и по результатам оперативного вмешательства. Пациенты были разделены на группы в соответствии со стадией заболевания, локализацией опухоли, степенью дифференцировки клеток опухоли, наличием или отсутствием метастазов (табл. 1).

Таблица 1. Характеристика пациентов, включенных в исследование

Клинико-морфологический параметр

Количество образцов

(n = 49)

Стадия заболевания

I стадия

10 (20 %)

II стадия

25 (51 %)

III стадия

9 (18 %)

IV стадия

5 (10 %)

Локализация опухоли

Восходящая, поперечная и нисходящая ободочная кишка

10 (20 %)

Сигмовидная кишка

6 (12 %)

Ректо-сигмовидный отдел

7 (14 %)

Прямая кишка

21 (43 %)

Не установлена

5 (14 %)

Степень дифференцировки опухоли

Высокая

6 (12 %)

Умеренная

35 (71 %)

Низкая

4 (8 %)

Не установлена

4 (8 %)

Метастазы

Присутствуют

16 (33 %)

Отсутствуют

33 (67 %)

Работа с кровью и образцами опухолей проводилась по международным правилам работы с биологическим материалом. Кровь брали натощак утром в день операции. Кусочки опухоли размером 2,0 х 2,0 х 2,0 мм иссекали в ходе плановых операций, промывали в физиологическом растворе, помещали в микропробирки, содержащие 500 мкл лизирующего буферного раствора (6 М гуанидинизотиоционат, 1 % Тритон X-100, 100 мМ ацетат Na, pH 7,0) и хранили при температуре -20 оС до использования. Исследовали также образцы периферической крови, смешанные с лизирующим буферным раствором в соотношении 1 : 1.

Сывороточный уровень суммарной и мономерной фракций растворимых молекул CD25 определяли в соответствии с предложенными ранее методами [6, 7].

Суммарную РНК из клеток выделяли методом фенол-хлороформной экстракции с последующей преципитацией спиртами [8]. При анализе мРНК IL-2Rα синтез кДНК на матрице мРНК и детекцию вариантов сплайсинга мРНК проводили с использованием разработанных ранее праймеров [5]. В качестве стандартных параметров полимеразной цепной реакции (ПЦР) были приняты следующие условия. Первоначальный прогрев смеси проводили 1 мин при 94 °С, денатурацию ДНК -30 сек при 94 °С, элонгацию - 45 сек при 72 °С, окончательную достройку цепей - 5 мин при 72 °С. Количество циклов для первого раунда ПЦР составило 40, для второго - 30. Электрофорез продуктов амплификации проводили в агарозном геле. Учет результатов осуществляли с помощью системы видеодокументирования Vilber Lourmat (Франция).

Для детекции мРНК Fas в реакции обратной транскрипции в качестве затравки использовали олигонуклеотид GR-20 (табл. 2). Детекцию вариантов сплайсинга мРНК Fas проводили методом ПЦР в два раунда. В первом раунде ПЦР использовали праймеры 1F и GR-20 и следующие условия: 35 х (94 °С - 30 сек, 55 °С - 30 сек, 72 °С - 45 сек). При детекции мРНК mFas, Fas del 5, Fas del 4, Fas del 3,4 второй раунд ПЦР проводили с комбинацией праймеров 1F и А. Для обнаружения мРНК sFas, Fas del 4,6, Fas del 3,4,6 во втором раунде ПЦР применяли праймеры 1F и Б. Условия второго раунда ПЦР: 25 х (94 °С - 30 сек, 60 °С - 30 сек, 72 °С - 45 сек).

Таблица 2. Олигонуклеотидные праймеры для детекции мРНК генов дифференцировочных молекул и раково-тестикулярных генов

Ген

Первичная cтруктура праймеров (5'- 3')

Fas

GR-20: GGATTTAAGGTTGGAGATTCA

1F: ATCCTGGGCATCTGGACCCT

А: TTCCTTTCTCTTCACCCAA

Б: TTCCTTTCTCTTCACTTCC

CD38

CD38-R1: AAgAAACTTgTCAggTCTgT

CD38-F1: CTATGGCCAACTGCGAGTTC

CD38-F2: ATGAGACATGTAGACTGCCA

CD38-R2: ATCCATTGAGCATCACATGG

ICAM-1

R1700: TGTTCA GTGTGGCACCACTG

F1220: GAGCTTCGT GTCCTGTATGG

R22: CTCATACCGGGGGGAGAGCA

TMR: CTCATACCGGGGGGCTCGCG

MAGEA1-6

MMRP1: actGaaGGaGaaGatctGcc

MA-R1: GTGCTTGGCCCCTCCTCTTC

MA-F2: AGGAGAAGATCTGCCWGTGG*

MA-R2: ctGGaGGctccctGaGGact

SSX1, 2, 4

SSX-F1: GAGAAGTTCCGAAAGGCCTT

SSX-R1: TTCTTGGGCATGATCTTCGGG

SSX-F2: AGGTTATGACTAAACTAGGT

SSX-R2: AAGTCATCTGAGGACGTTCA

XAGE1

X-F1: ctactGaGacacGGcGGaca

X-R1: ttGtttcaGcttGtcttcat

X-F2: atacaGctGaGatcccaGtG

X-R2: ttGtGGttGctcttcacctG

NY-ESO-1

NY-F1: AGAGCCGCCTGCTTGAGTTC

NY-R1: TCTGCAGCAGTCAGTCGGAT

NY-F2: CCTGCTTGAGTTCTACCTCG

NY-R2: GCAGTCAGTCGGATAGTCAG

GAGE1-8

G-F1: attGGGcctatGcGGcccGa

G-R1: TCCAACAYAGGAGCAGCCTG*

G-F2: AGCATCTGCAGSTCAAGGGC*

G-R2: tcttttaaCActGtGattGc

PAGE1

P-F1: CGTAGACCAATGATCTATGT

CT7

C-F1: cctatccaGtcttcaaGGtG

C-R1: caGGacaactctGaGGactc

C-F2: aGtGccaGGaGtcaaGGttc

C-R2: GCATATCCTTGTCCCCCATG

TRAG3

T-F: AGAAGCCCTATCAAAGTTCC

T-R1: TTGTGGTCCCGCTATGGCTC

T-R2: TCGTTCGGCTGGTCAGAGTG

Примечание. * - для обозначения вырожденных оснований использован общепринятый код: S - C/G, W - T/A, Y - T/C.

Обратную транскрипцию мРНК CD38 проводили с использованием праймера CD38-R1. Полученную кДНК амплифицировали в двухраундовой ПЦР. В первом раунде ПЦР использовали праймеры CD38-F1 и CD38-R1 и следующие температурные условия: 94 оС - 30 сек, (94 оС - 30 сек, 57 оС - 30 сек, 72 оС - 45 сек) х 35, 72 оС - 5 мин. Второй раунд ПЦР для одновременной детекции двух форм мРНК CD38 (CD38 и CD38Exo3Del) проводили с праймерами CD38-F2 и CD38-R2 при следующих температурных условиях: 94 оС - 30 сек, (94 оС - 30 сек, 62 оС - 30 сек, 72 оС -45 сек) х 25, 72 оС - 5 мин.

Синтез кДНК ICAM-1 проводили в реакции обратной транскрипции с праймером R1700. Две альтернативные формы мРНК ICAM-1 определяли с использованием общего прямого праймера F1220. Обратный праймер для детекции мРНК мембранной формы ICAM-1 - R22, для детекции мРНК растворимой формы sICAM-1 - TMR. Детекцию матричной РНК осуществляли в ПЦР при следующих условиях: 94 оС - 30 сек, (94 °С - 30 сек, 66 °С - 45 сек, 72 °С - 60 сек) х 50, 72 оС - 5 мин.

При детекции мРНК раково-тестикулярных генов в качестве затравки в реакции обратной транскрипции применяли смесь олигонуклеотидов, специфичных для мРНК MAGEA1-MAGEА6, CT7 (MAGEC1), GAGE1-GAGE8, NY-ESO-1, SSX1,2,4 и XAGE1, обозначенных R1 (табл. 2). Полученные образцы кДНК амплифициро-вали, используя метод ПЦР в два раунда для раздельного выявления мРНК каждого из семейств исследуемых белков. Для каждой из тестируемых мРНК проводили 35 циклов первой и 25 циклов второй ПЦР при следующих условиях: 94 °С - 30 сек, 55 °С - 30 сек, 72 °С -30 сек. Для обнаружения мРНК PAGE1 в первом раунде ПЦР использовали праймеры P-F1 и G-R1, во втором - G-F2 и G-R2. При детекции мРНК TRAG3 в обоих раундах ПЦР применяли прямой праймер T-F [9-11].

Статистическую обработку результатов проводили с помощью пакета программ Statistica v. 8.0. Анализ различий относительных частот обнаружения мРНК в группах проводили с использованием статистического критерия сравнения пропорций. Для представления исследованных количественных показателей были использованы медиана, 25 и 75 процентили. Межгрупповой анализ количественных показателей проводили с использованием непараметрического U-критерия Манна-Уитни. При анализе качественных и количественных признаков различия считали статистически значимыми при р < 0,05.

Результаты

Во всех тестированных образцах периферической крови здоровых доноров и пациентов с раком толстой кишки были обнаружены три альтернативных варианта мРНК a-цепи рецептора ИЛ-2: полноразмерная форма (мРНК CD25), форма с делецией 4-го экзона (мРНК CD25Exo4Del) и форма с делецией 4-го и 5-го экзонов (мРНК CD25Exo4-5Del). Результаты соответствуют литературным данным, полученным ранее при исследовании клеток крови здоровых лиц [12]. При анализе образцов опухолей пациентов с раком толстой кишки обнаружена другая картина. Полноразмерная форма мРНК CD25 была выявлена в 98 % случаев (48 из 49 пациентов) (рис. 1). У пациента без данной формы мРНК CD25 была диагностирована умереннодифференцированная аденокарцинома сигмовидной кишки II стадии.

Рис. 1. Частота выявления альтернативных форм мРНК IL-2 в образцах опухолевых очагов пациентов с раком толстой кишки

* - статистически значимые различия по сравнению с частотой выявления мРНК CD25(р = 0,002); ** - статистически значимые различия по сравнению с частотой выявления мРНК CD25Exo4Del (р = 0,032).

В одном из тестированных образцов опухолевых очагов пациентов с раком толстой кишки присутствовала только полноразмерная форма мРНК CD25. У данного пациента была диагностирована низкодифференцированная аденокарцинома восходящего отдела ободочной кишки III стадии развития, обнаружено метастазирование. Матричная РНК с делецией 4-го экзона была детектирована в 92 % тестированных образцов (45 из 49 пациентов) (см. рис. 1). Четыре пациента, в опухолевых очагах которых не была выявлена мРНК CD25Exo4Del, характеризовались различной локализацией опухолевого процесса (рак прямой кишки, рак сигмовидной кишки, рак восходящего отдела ободочной кишки), степенью дифференцировки опухоли - от низкой до высокой, и стадиями заболевания - от I до III. Три пациента из четырех подверглись операции Гартмана. К моменту операции у них не было обнаружено метастазов. У одного пациента без мРНК CD25Exo4Del были детектированы метастазы. Вариант сплайсинга мРНК IL-2Rα без экзонов 4 и 5 в исследуемых образцах обнаружен в 76 % случаев (37 из 49 пациентов). Частота детекции этого варианта мРНК статистически значимо ниже, чем частота детекции полноразмерной формы мРНК = 0,002) и формы мРНК CD25Exo4Del = 0,032).

Три тестированные альтернативные формы мРНК IL-2Raα встречались в опухолях пациентов с раком толстой кишки на всех четырех стадиях заболевания (табл. 3). Полноразмерная форма мРНК CD25 в 100 % случаев выявлена в клетках опухолевых очагов на I, III и IV стадиях. В группе пациента со II стадией рака толстой кишки у одного пациента полноразмерная мРНК отсутствовала. Сплайсинговый вариант мРНК с делецией 4-го экзона в 100 % случаев обнаружен только у пациентов с раком толстой кишки IV стадии. На первых трех стадиях этот вариант мРНК выявлен в 89-92 % случаев. На всех стадиях рака толстой кишки мРНК CD25Exo4-5Del обнаружена с меньшей частотой. На первых трех стадиях частота ее выявления варьировала от 70 до 89 %, а на IV стадии эта форма была определена лишь у двух из пяти тестированных пациентов (40 %). Различия в частоте обнаружения данной формы мРНК в сравнении с другими на каждой из стадий были статистически недостоверны, что, вероятно, связано с небольшим числом тестированных пациентов. Тем не менее, наблюдалась выраженная тенденция к уменьшению частоты выявления мРНК CD25Exo4-5Del по сравнению с мРНК CD25 и мРНК CD25Exo4Del на каждой стадии заболевания.

Различия в локализации первичного опухолевого узла и гистологическом типе опухоли не сопровождались изменениями частоты встречаемости альтернативных форм мРНК CD25 и CD25Exo4Del (табл. 3). Однако наблюдались статистически значимые различия в частоте обнаружения мРНК CD25Exo4-5Del. Она чаще встречалась в опухолевых очагах, локализованных в прямой кишке, чем в ректосигмоидном отделе = 0,012) и сигмовидной кишке = 0,037).

Таблица 3. Частота обнаружения альтернативных форм мРНК IL-2 в опухолях пациентов раком толстой кишки

Характеристика заболевания

мРНК

CD25

CD25Exo4Del

CD25Exo4-5Del

абс.

%

абс.

%

абс.

%

Стадия заболевания

I

10/10

100

9/10

90

7/10

70

II

24/25

96

23/25

92

20/25

80

III

9/9

100

8/9

89

8/9

89

IV

5/5

100

5/5

100

2/5

40

Локализация опухоли

Восходящая, поперечная и нисходящая ободочная кишка

10/10

100

8/10

80

7/10

70

Сигмовидная кишка

5/6*

83

5/6*

83

3/6

50

Ректо-сигмовидный отдел

7/7*

100

7/7*

100

5/7

41

Прямая кишка

21/21

100

19/21

90

19/21

90

Гистологическая форма

Высокодифференцированная

6/6

100

5/6

83

4/6

67

Умеренно-дифференцированная

34/35*

97

33/35*

94

27/35

77

Низкодифференцированная

4/4

100

3/4

75

3/4

75

Метастазы

Есть

16/16 *

100

15/16

94

12/16

75

Нет

32/33*

97

30/33

91

25/33

76

Примечание. * - статистически значимые различия по сравнению с частотой выявления мРНК CD25Exo4-5Del < 0,05).

При сравнении встречаемости трех форм мРНК IL-2Rα в клетках опухолевых очагов между группами пациентов с наличием и отсутствием метастазов статистически значимых различий не обнаружено. Однако наблюдалась тенденция к уменьшению частоты обнаружения мРНК в ряду "CD25 - CD25Exo4Del - CD25Exo4-5Del" у пациентов как с метастазами, так и без них. Частота выявления полноразмерной формы мРНК CD25 была статистически значимо выше, чем частота обнаружения формы мРНК с делецией экзонов 4 и 5 = 0,041 и р = 0,015 соответственно) (см. табл. 3).

Хорошо известно, что ген, кодирующий IL-2Rα, является активационным, т.е. его экспрессия значительно повышается в активированных клетках, потенциально способных к пролиферации. Сходным образом ведут себя гены, кодирующие молекулы CD38, ICAM-1 и Fas [13-15]. Для изучения связи между экспрессией гена IL-2RA и генов дифференцировочных молекул CD38, ICAM-1 и Fas была проанализирована экспрессия данных генов в опухолях пациентов, содержащих и не содержащих мРНК CD25Exo4-5Del. В анализ были взяты не только полноразмерные формы мРНК CD38 и ICAM-1 и Fas, но и делетированные варианты мРНК их генов, представленные в табл. 4 [16-19].

Таблица 4. Частота обнаружения мРНК дифференцировочных генов в опухолях пациентов с раком толстой кишки

мРНК дифференцировочных генов

мРНК CD25Exo4-5Del

присутствует

отсутствует

абс.

%

абс.

%

CD38

24/36

67

7/10

70

CD38Exo3Del

10/36

28

2/10

20

ICAM-1

35/37*

95

5/11

45

sICAM-1

11/37

30

3/11

27

mFas

37/37

100

12/12

100

Fas del 5

8/37

22

5/12

42

Fas del 4

10/37

27

3/12

25

Fas del 3, 4

33/37

89

11/12

92

sFas

36/37

97

11/12

92

Fas del 4, 6

17/37

46

7/12

58

Fas del 3, 4, 6

33/37

89

8/12

67

Примечание. * - статистически значимые различия по сравнению с частотой обнаружения мРНК ICAM-1 в CD25Exo4-5Del-негативных опухолях (р < 0,001).

Частота обнаружения семи альтернативных форм мРНК Fas, двух форм мРНК CD38 и мРНК ICAM-1 незначительно варьировала между группами пациентов, содержащих и не содержащих мРНК CD25Exo4-5Del в опухолевом очаге. Тем не менее, мРНК ICAM-1 встречалась в 2,1 раза чаще в опухолях, содержащих мРНК CD25Exo4-5Del, чем в CD25Exo4-5Del-негативных опухолях < 0,001) (см. табл. 4). В соответствии с этим, в опухолях, позитивных по мРНК ICAM-1, чаще, чем в негативных по мРНК ICAM-1, выявлялись мРНК CD25 и CD25Exo4-5Del = 0,032 и р < 0,001) (табл. 5). Показано, что при раке толстой кишки повышенный уровень экспрессии ICAM-1 клетками опухолей ассоциирован с высокодифференцированными новообразованиями, а также с высокой восприимчивостью к лизису цитотоксическими Т-лимфоцитами [20, 21]. Таким образом, наличие мРНК CD25Exo4-5Del в опухолевых очагах пациентов с раком толстой кишки можно рассматривать как свидетельство благоприятного течения заболевания.

Таблица 5. Частота обнаружения альтернативных форм мРНК IL-2 в опухолях пациентов с раком толстой кишки

мРНК дифференцировочных и раково-тестикулярных генов

Альтернативные варианты мРНК ИЛ-2

CD25

CD25Exo4Del

CD25Exo4-5Del

абс.

%

абс.

%

абс.

%

CD38+

CD38-

30/31

15/15

98

100

28/31

15/15

90

100

25/31^

12/15

81

80

CD38Exo3Del+

CD38Exo3Del-

12/12

33/34

100

97

11/12

32/34^^

92

94

10/12

26/34^

83

76

ICAM-1+

ICAM-1-

40/40*

7/8

100

88

38/40

6/8

95

75

35/40*

2/8

88

25

sICAM-1+

sICAM-1-

14/14

33/34

100

97

13/14 31/34

93

91

11/14

26/34^

79

77

mFas+

mFas-

48/49

0/0

98

0

45/49

0/0

92

0

37/49^

0/0

76

0

Fas del 5+

Fas del 5-

13/13

35/36

100

97

13/13^^

32/36

100

89

8/13^

29/36^

62

81

Fas del 4+

Fas del 4-

13/13

35/36

100

97

12/13 33/36

92

92

10/13

27/36^

77

75

Fas del 3, 4+

Fas del 3, 4-

44/44

4/5

100

80

43/44^^

2/5

98

40

33/44^

4/5

75

80

sFas+

sFas-

46/47

2/2

98

100

43/47

2/2

91

100

36/47^

1/2

77

50

Fas del 4, 6+

Fas del 4, 6-

24/25

24/24

96

100

22/25 23/24

88

96

18/25^

19/24^

72

79

Fas del 3, 4, 6+

Fas del 3, 4, 6-

40/41

8/8

98

100

38/41

7/8

93

88

33/41^

4/8^

80

50

Примечание. * - статистически значимые различия по сравнению с частотой выявления мРНК в ICAM-1--опухолях (р < 0,05); ^ - статистически значимые различия по сравнению с частотой выявления мРНК CD25 (р < 0,05); ^^ - статистически значимые различия по сравнению с частотой выявления мРНК CD25Exo4-5Del< 0,05).

Различий экспрессии раково-тестикулярных генов в опухолевых очагах, содержащих и не содержащих различные варианты мРНК IL-2Rα, не обнаружено (данные не представлены). Наряду с определением мРНК в опухолевых очагах пациентов с раком толстой кишки проведено определение содержания суммарной и олигомерной фракций растворимой молекулы CD25 (sCD25) в сыворотке крови пациентов (табл. 6). Статистически значимых различий содержания суммарной фракции sCD25 в сыворотке крови пациентов с наличием и отсутствием в опухолевых очагах альтернативных форм мРНК IL-2Ra не обнаружено. Статистически значимые различия отсутствовали также при сравнении со здоровыми донорами крови.

Таблица 6. Уровень суммарной и олигомерной фракций sCD25 в сыворотке крови пациентов с раком толстой кишки (U/ml)

мРНК

Фракция sCD25

суммарная

олигомерная

CD25

Есть

367,7 (313,0; 427,5)

302,3 (266,5; 397,3)

Нет

273,0

не тестировали

CD25Exo4Del

Есть

365,8 (305,0; 427,5)

302,3 (261,5; 390,5)

Нет

369,2 (317,7; 409,3)

1047,0 (271,4; 1822,5)

CD25Exo4-5Del

Есть

355,0 (285,0; 416,0)

292,8 (258,4; 397,3)

Нет

377,0 (339,2; 433,8)

319,2 (286,0; 437,4)

Результаты указывают на то, что особенности экспрессии гена IL2RA в опухолевых очагах не отражаются на содержании в сыворотке крови суммарной фракции молекул sCD25, которые, как известно, являются продуктом пост-трансляционной модификации белка, образуются путем протеолитического срезания с клеточной мембраны и способны поступать в кровоток, где выполняют супрессорную функцию [22]. Однако в сыворотке крови пациентов, в опухолевых очагах которых не определялась мРНК CD25Exo4Del, выявлена выраженная, хотя и статистически не значимая, тенденция к повышению содержания олигомерной фракции молекул sCD25 в сравнении с пациентами, в опухолевых очагах которых мРНК CD25Exo4Del детектировалась. Кроме того, обнаружено статистически значимое повышение уровня олигомерной фракции в 2,6 раза в сравнении со здоровыми донорами < 0,05). Этот факт свидетельствует о возможной регуляторной роли мРНК IL-2Rα, не содержащей в своем составе 4-го экзона, или ее белкового продукта. Можно предположить, что при отсутствии кодируемой мРНК CD25Exo4Del α-цепи, не способной связывать ИЛ-2, резко повышается скорость шеддинга полноразмерной молекулы CD25, а это проявляется в повышении ее концентрации в периферической крови. В результате на системном уровне может возникать торможение активационных процессов, основанное на связывании ИЛ-2 растворимыми молекулами CD25.

Как указано выше, все три исследуемые формы мРНК IL-2Rα были обнаружены в 100 % тестированныхобразцов периферической крови как у пациентов с раком толстой кишки, так и у здоровых доноров крови. При этом в опухолевых очагах частота обнаружения всех трех альтернативных форм мРНК IL-2Rα составила 64 % и оказалась статистически значимо ниже, чем в крови пациентов с раком толстой кишки и доноров крови = 0,046). Таким образом, в клетках опухолевых очагов части пациентов с раком толстой кишки обнаруживаются изменения в спектре альтернативных форм мРНК IL-2Rα, отсутствующие в клетках периферической крови. Изменения чаще всего связаны с потерей мРНК, имеющей делецию 4-го и 5-го экзонов, и могут принадлежать или непосредственно опухолевым клеткам, или лимфоидным клеткам, инфильтрирующим опухоль.

Обсуждение

По результатам исследования образцов опухолевых очагов пациентов с колоректальным раком, проведенного ранее, мРНК IL-2Ra была детектирована в 58 % (7/12) случаев, что согласуется с данными, представленными в настоящей работе [20]. Присутствие мРНК IL-2Rα в опухолевых клетках было показано при ряде других новообразований [23-25].

Данные литературы свидетельствуют, что экспрессия гена IL-2RA в раковой клетке является одним из молекулярных механизмов экспансии опухолевых клонов и ассоциирована с высоким уровнем злокачественности опухоли. Установлено, что высокая экспрессия IL-2RA в неопластических клетках приводит к повышению их пролиферативной, трансформирующей активности, устойчивости к лекарственным препаратам и коррелирует с неблагоприятным прогнозом для пациента [1]. Однако во всех упомянутых случаях анализировалась мРНК IL-2Ra полноразмерной формы или ее белковый продукт. Как показано в настоящей работе, в опухолях одновременно в большинстве случаев присутствовали и делетированные формы мРНК. Можно предположить, что кодируемые ими белки конкурируют с полноразмерными α-цепями за включение в состав высокоаффинного рецептора и тем самым осуществляют ограничительную регуляторную функцию. Однако по мере развития опухолевого процесса частота встречаемости мРНК CD25Exo4-5Del падала, достигая минимума на IV стадии. Отсутствие делетированной мРНК должно приводить в этой ситуации к более эффективному связыванию ИЛ-2 и пролиферации клеток, что наблюдается на поздних стадиях опухолевого роста.

Другим источником мРНК IL-2Rα в опухолевых очагах пациентов с раком толстой кишки могут быть лимфоциты, инфильтрирующие опухоль, в частности CD4+CD25+-Трег [26]. Важной характеристикой CD4+CD25+-Трег является высокая экспрессия a-цепи рецептора ИЛ-2 на их мембране. Функциональная роль данной субпопуляции клеток заключается в том, что они оказывают мощный регуляторно-супрессирующий эффект на пролиферацию других Т-клеток in vitro и подавляют их функции in vivo.Активированные CD4+-клетки также экспрессируют на своей поверхности молекулу CD25, но временно и в значительно меньших количествах по сравнению с Tрег [27].

Нами показано, что три альтернативные формы мРНК IL-2Rα в периферической крови пациентов с раком толстой кишки, так же, как и в крови здоровых добровольцев, определяются в 100 % случаев и, видимо,таким образом обеспечивают полноценную работу системы "ИЛ-2 - его рецептор". В опухолях делетированные формы мРНК IL-2Rα и в первую очередь - мРНК CD25Exo4-5Del выявляются значительно реже. Вероятно, потеря делетированных форм на поздних стадиях заболевания приводит к дисбалансу в содержании альтернативных вариантов мРНК IL-2Rα не только в опухолевых клетках, но и в инфильтрирующих опухоль лимфоцитах, в первую очередь - Трег. Причина и механизм формирования такого дисбаланса остаются неясными, однако результатом может стать повышение уровня активации Трег за счет отсутствия на мембране продуктов делетированных форм мРНК IL-2Rα, не способных связывать ИЛ-2 и играющих роль ограничителя количества функционально активных рецепторов ИЛ-2. Усиление супрессорной активности Трег, как известно, служит одной из причин прогрессии опухоли. Для проверки изложенных предположений необходимы дополнительные исследования.

Заключение

Продемонстрировано присутствие альтернативных форм мРНК IL-2Ra CD25Exo4Del и CD25Exo4-5Del в опухолевых очагах и периферической крови пациентов с раком толстой кишки. Представлены данные о частоте их выявления и частоте выявления полноразмерной формы мРНК CD25 в опухолевых очагах пациентов с различными гистологическими формами рака толстой кишки, на различных стадиях заболевания, при различной локализации опухоли, при метастазах, в сравнении с особенностями транскриптома клеток опухолевых очагов и уровнем растворимой формы дифференцировочной молекулы CD25 в сыворотке крови. Полученные данные позволяют высказать предположение о регуляторной роли продуктов делетированных форм мРНК IL-2Rα, отсутствие которых в опухолевых очагах пациентов с раком толстой кишки может приводить к активации Трег, усилению иммуносупрессии и прогрессии опухоли.

Литература

1. Kuhn D.J., Dou Q.P. The role of interleukin-2 receptor alpha in cancer. Front. Biosci. 2005; 10: 1462-74. DOI: 10.2741/1631.

2. Cosman D. Cloning, sequence and expression of human interleukin-2 receptor. Nature. 1984; 312 (5996): 768-71. DOI: 10.1038/312768a0.

3. Castrignano T., D’Antonio M., Anselmo A. Carrabino D. et al. ASPicDB: a databaseresource for alternative splicing analysis. Bioinformatics. 2008; 24 (10): 1300-4. DOI: 10.1093/bioinformatics/btn113.

4. Ishida N., Kanamori H., Noma T., Nikaido T. et al. Molecular cloning and structure of the human interleukin 2 receptor gene. Nucleic Acids Res. 1985; 13 (21): 7579-89. DOI: 10.1093/nar/13.21.7579.

5. Новикова С.В. (Шумилова С.В.), Алясова А.В., Новиков Д.В. Разработка и апробация метода детекции мРНК альфа-цепи рецептора интерлейкина-2 в клетках опухолевых очагов человека. Вестник Нижегородского университета им. Н.И. Лобачевского. 2010; 2 (2): 563-65.

6. Kubysheva N., Postnikova L., Soodaeva S., Novikov V. et al. Relationship of the content of systemic and endobronchial soluble molecules of CD25, CD38, CD8, and HLA-I-CD8 and Lung function parameters in COPD patients. Dis. Markers. 2017. Vol. 2017. DOI:10.1155/2017/8216723.

7. Novikov V.V., Egorova N.I., Kurnikov G.Yu., Evsegneeva I.V. The Serum level of soluble HLA molecules and IL-2R at urogenital chlamydial infection. Adv. Exp. Med. Biol. 2007; 601: 285-89.

8. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987; 162 (1): 156-59. DOI: 10.1006/abio.1987.9999.

9. Новиков В.В., Евсегнеева И.В. Новые дифференцировочные антигены человека, утвержденные на VII Международном Воркшопе. Российский биотерапевтический журнал. 2003; 2 (3): 3-6.

10. Голышко П.В., Новиков Д.В., Ананьев С.В., Барышников К.А. и др. Раково-тестикулярные гены в крови и опухоли больных колоректальным раком. Российский биотерапевтический журнал. 2015; 1: 19-25.

11. Новиков Д.В., Белова Т.В., Пегов Р.Г., Алясова А.В. и др. Частота обнаружения мРНК MAGE-А1-А6 в крови онкологических больных. Клиническая лабораторная диагностика. 2009; 4: 25-7.

12. Choi C. Homo sapiens interleukin-2 receptor mRNA, alternatively spliced, partial CDS. In: Submitted Neurology. Shinchon-dong, South Korea : Yonsei University, 1997. URL: http://www.ncbi.nlm.nih.gov/nuccore/AF008556.1.

13. Nagata S., Golstein P. The Fas death factor. Science. 1995; 267: 1449-56. DOI: 10.1126/science.7533326.

14. Deaglio S., Mehta K., Malavasi F. Human CD38: a (r)evolutionary story of enzymes and receptors. Leuk. Res. 2001; 25 (1): 1-12. DOI: 10.1016/s0145-2126(00)00093-x.

15. Wingren A.G., Parra E., Varga M., Kalland T. T cell activation pathways: B7, LFA-3, and ICAM-1 shape unique T cell profiles. Crit. Rev. Immunol. 2017; 37 (2-6): 463-81. DOI: 10.1615/critrevimmunol.v15.i3-4.30

16. Perenkov A.D., Novikov D.V., Sakharnov N.A. et al. Heterogeneous CD38 expression in tumor tissues of patients with colorectal cancer. Mol. Biol. 2012; 46 (5): 705-9.

17. Новиков Д.В., Фомина С.Г., Гурина Н.Н., Перенков А.Д. и др. Корреляция экспрессии MUC1, ICAM1, IL32, FcγR3A и FoxP3 в опухолевых очагах больных раком молочной железы. Клиническая лабораторная диагностика. 2017; 1: 37-41.

18. Голенков А.К., Митина Т.А., Новиков В.В. и др. Клиническое значение растворимых молекул адгезии (sCD50-ICAM-3), апоптоза (sCD95) и sHLA класса I при лимфопролиферативных заболеваниях. Российский биотерапевтический журнал. 2002; 1 (1): 60-4.

19. Уткин О.В., Свинцова Т.А., Кравченко Г.А., Шмелева О.А. и др. Экспрессия альтернативных форм гена CD95/FAS в клетках крови при герпес-вирусной инфекции. Иммунология. 2012; 33 (4): 189-93.

20. Wang Q., Li B., Liu B., Liu Y.B. et al. Polymorphisms of the ICAM-1 exon 6 (E469K) are associated with differentiation of colorectal cancer. J. Exp. Clin. Cancer Res. 2009; 28: 139-45. DOI: 10.1186/1756-9966-28-139.

21. Hamai A., Meslin F., Benhalam H., Jalil A. et al. ICAM-1 has a critical role in the regulation of metastatic melanoma tumor susceptibility to CTL lysis by interfering with PI3K/AKT pathway. Cancer Res. 2008; 68 (23): 9854-64. DOI: 10.1158/0008-5472.CAN-08-0719.

22. Новиков В.В., Караулов А.В., Барышников А.Ю. Растворимые формы мембранных антигенов клеток иммунной системы. Москва : Медицинское информационное агентство. 2008: 249 с.

23. García-Tuñón I., Ricote M., Ruiz A., Fraile B. et al. Interleukin-2 and its receptor complex (alpha, beta and gamma chains) in in situ and infiltrative human breast cancer: an immunohistochemical comparative study. Breast Cancer Res. 2004; 6 (1): R1-7. DOI: 10.1186/bcr730.

24. Loose D., Signore A., Bonanno E., Vermeersch H. et al. Prognostic value of CD25 expression on lymphocytes and tumor cells in squamous-cell carcinoma of the head and neck. Cancer Biother. Radiopharm. 2008; 23 (1): 25-33. DOI: 10.1089/cbr.2007.0373.

25. McDoniels-Silvers A.L., Stoner G.D., Lubet R.A., You M. Differential expression of critical cellular genes in human lung adenocarcinomas and squamous cell carcinomas in comparison to normal lung tissues. Neoplasia. 2002; 4 (2): 141-50. DOI: 10.1038/sj.neo.7900217.

26. Guoping D. Tumor-infiltrating regulatory T cells: origins and features. Am. J. Exp. Immunol. 2018; 7 (5): 81-7.

27. Baecher-Allan C., Brown J.A., Freeman G.J., Hafler D.A. CD4+CD25high regulatory cells in human peripheral blood. J. Immunol. 2001; 167 (3): 1245-53. DOI: 10.4049/jimmunol.167.3.1245.


Журналы «ГЭОТАР-Медиа»